SOX9 Human Gene Knockout Kit (CRISPR)
CAT#: KN208944LP
SOX9 - human gene knockout kit via CRISPR, HDR mediated
Functional Cassette: GFP-puro RFP-BSD mBFP-Neo
HDR-mediated knockout kit validation
Specifications
Product Data | |
Format | 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control |
Donor DNA | Luciferase-Puro |
Symbol | SOX9 |
Locus ID | 6662 |
Components | KN208944G1, SOX9 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GCTCGGACACCGAGAACACG KN208944G2, SOX9 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TCTGAAGAAGGAGAGCGAGG KN208944LPD, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_000346 |
UniProt ID | P48436 |
Synonyms | CMD1; CMPD1; SRA1; SRXX2; SRXY10 |
Summary | The protein encoded by this gene recognizes the sequence CCTTGAG along with other members of the HMG-box class DNA-binding proteins. It acts during chondrocyte differentiation and, with steroidogenic factor 1, regulates transcription of the anti-Muellerian hormone (AMH) gene. Deficiencies lead to the skeletal malformation syndrome campomelic dysplasia, frequently with sex reversal. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
|
SDS |
Resources
Other Versions
SKU | Description | Size | |
---|---|---|---|
KN208944 | SOX9 - human gene knockout kit via CRISPR, HDR mediated | 1 657,00 EUR | |
KN208944BN | SOX9 - human gene knockout kit via CRISPR, HDR mediated | 1 657,00 EUR | |
KN208944RB | SOX9 - human gene knockout kit via CRISPR, HDR mediated | 1 657,00 EUR | |
KN408944 | SOX9 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. | 1 657,00 EUR | |
GA104571 | SOX9 CRISPRa kit - CRISPR gene activation of human SRY-box transcription factor 9 | 1 657,00 EUR |