Specifications

Product Data
Gene ID	12043
Forward Sequence	CCTGTGGATGACTGAGTACCTG
Reverse Sequence	AGCCAGGAGAAATCAAACAGAGG
Accession No	BC068988, BC095964, NM_009741, NM_009741.1, NM_009741.2, NM_009741.3, NM_009741.4, NM_009741.5, BB612176, BB662051, BQ887357, BY118935
UniProt ID	P10417
Synonyms	AW986256; Bcl-; Bcl-2; C430015F12Rik; D630044D05Rik; D830018M01Rik
Component	1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control	The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage	Store at -20°C.
Stability	The primer mix is stable for one year from date of shipping.